Accession | MI0008554 | ||||
Name | ptr-mir-155 | ||||
similar to following miRCarta precursors | ptr-109.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
21:11,762,135-11,762,198 (+) |
||||
miRNA | ptr-miR-155 | ||||
Sequence (5' -> 3') (64 nts) |
UGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAAAUGACUCCUACAUAUUAGCAUUAACAG | ||||
MFE | -28.40 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
ptr-mir-155 |
||||
Family | mir-155 (MIPF0000157) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |