| Accession | MI0008553 | ||||
| Name | ptr-mir-153 | ||||
| similar to following miRCarta precursors | ptr-501.1 | ||||
| Organism | Pan troglodytes | ||||
| miRNA | ptr-miR-153 | ||||
| Sequence (5' -> 3') (86 nts) |
AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGU | ||||
| MFE | -42.10 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-153 (MIPF0000050) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |