| Accession | MI0008403 | ||||
| Name | ptr-let-7e | ||||
| similar to following miRCarta precursors | ptr-50.1 | ||||
| potential naming conflicts with | ptr-let-7e (MIMAT0007940) | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:56,580,917-56,580,994 (+) |
||||
| miRNA | ptr-let-7e | ||||
| Sequence (5' -> 3') (78 nts) |
CCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG | ||||
| MFE | -35.80 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
ptr-mir-99b
ptr-let-7e ptr-mir-125a |
||||
| Family | let-7 (MIPF0000002) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |