Accession | MI0008401 | ||||
Name | ptr-let-7c | ||||
similar to following miRCarta precursors | ptr-37.1 | ||||
potential naming conflicts with | ptr-let-7c (MIMAT0007938) | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
21:2,999,744-2,999,826 (+) |
||||
miRNA | ptr-let-7c | ||||
Sequence (5' -> 3') (83 nts) |
CAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGC | ||||
MFE | -30.00 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
ptr-mir-99a
ptr-let-7c |
||||
Family | let-7 (MIPF0000002) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |