| Accession | MI0008400 | ||||
| Name | ptr-let-7b | ||||
| similar to following miRCarta precursors | ptr-14.1 | ||||
| potential naming conflicts with | ptr-let-7b (MIMAT0007937) | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
22:44,926,186-44,926,267 (+) |
||||
| miRNA | ptr-let-7b | ||||
| Sequence (5' -> 3') (82 nts) |
GGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCAGAAGAUAACUAUACAACCUACUGCCUUCCCUG | ||||
| MFE | -45.10 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ptr-let-7a-3
ptr-let-7b |
||||
| Family | let-7 (MIPF0000002) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |