| Accession | MI0008346 | ||||
| Name | bmo-mir-184 | ||||
| similar to following miRCarta precursors | bmo-30217-30216.1 | ||||
| Organism | Bombyx mori | ||||
| Genome | SILKDB2.0 | ||||
| Location |
nscaf2964:4,754,656-4,754,739 (-) |
||||
| miRNA | bmo-miR-184-5p | ||||
| miRNA | bmo-miR-184-3p | ||||
| Sequence (5' -> 3') (84 nts) |
GUGCAGUGACGUGCCCUUGUCAUUCUUCAGGCCCUGUGUAUUUACAACUACUGGACGGAGAACUGAUAAGGGCACGCCGUGUAC | ||||
| MFE | -35.70 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bmo-mir-184 |
||||
| Family | mir-184 (MIPF0000059) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cao et al. | Insect Biochem. Mol. Biol. | 2008 | 18977439 | Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system. |
| 2 | He et al. | BMC Genomics | 2008 | 18507836 | Identification and characteristics of microRNAs from Bombyx mori. |
| 3 | Liu et al. | BMC Genomics | 2010 | 20199675 | MicroRNAs of Bombyx mori identified by Solexa sequencing. |