| Accession | MI0008329 | ||||
| Name | hsa-mir-1908 | ||||
| similar to following miRCarta precursors | hsa-915-2129.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr11:61,815,161-61,815,240 (-) |
||||
| miRNA | hsa-miR-1908-5p | ||||
| miRNA | hsa-miR-1908-3p | ||||
| Sequence (5' -> 3') (80 nts) |
CGGGAAUGCCGCGGCGGGGACGGCGAUUGGUCCGUAUGUGUGGUGCCACCGGCCGCCGGCUCCGCCCCGGCCCCCGCCCC | ||||
| MFE | -46.20 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-1908 |
||||
| Family | mir-1908 (MIPF0001021) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bar et al. | Stem Cells | 2008 | 18583537 | MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries. |
| 2 | Nygaard et al. | BMC Med Genomics | 2009 | 19508715 | Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing. |
| 3 | Creighton et al. | PLoS ONE | 2010 | 20224791 | Discovery of novel microRNAs in female reproductive tract using next generation sequencing. |
| 4 | Plé et al. | PLoS ONE | 2012 | 23226537 | The repertoire and features of human platelet microRNAs. |