Precursor miRBase

ssc-mir-210 (MI0008220)

Accession MI0008220
Name ssc-mir-210
similar to following miRCarta precursors ssc-102.1
Organism Sus scrofa
Genome Sscrofa10.2
Location chr2:339,074-339,149 (+)
miRNA ssc-miR-210
Sequence (5' -> 3')
(76 nts)
GCGCAGGGCAGCCACUGCCCACCGCACACUGCGCUGCUCCGGACCCACUGUGCGUGUGACAGCGGCUGAUCUGUCC
MFE -31.90 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
ssc-mir-210
Family mir-210 (MIPF0000086)
Experiments
experiment Pubmed link
Illumina 21312241 24499489 19917043
cloned 18548309
External DBs
Gene symbol MIR210
NCBI Gene 100316612

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Mamm. Genome 2008 18548309 Identification and characterization of new microRNAs from pig.
2 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
3 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
4 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.