Precursor miRBase

ssc-mir-16-1 (MI0008213)

Accession MI0008213
Name ssc-mir-16-1
similar to following miRCarta precursors ssc-61.1
potential naming conflicts with ssc-mir-16-2 (MI0008212)
Organism Sus scrofa
Genome Sscrofa10.2
Location chr13:108,388,290-108,388,366 (+)
miRNA ssc-miR-16
Sequence (5' -> 3')
(77 nts)
UCCGCUCUAGCAGCACGUAAAUAUUGGCGUAGUAAAAUAAAUAUUAAACACCAAUAUUAUUGUGCUGCUUUAGCGUG
MFE -29.50 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
ssc-mir-15b
ssc-mir-16-1
Family mir-15 (MIPF0000006)
Experiments
experiment Pubmed link
Illumina 21312241 24499489 19917043
cloned 20180025 18548309
External DBs
Gene symbol MIR16-1
NCBI Gene 100316611

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Mamm. Genome 2008 18548309 Identification and characterization of new microRNAs from pig.
2 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
3 Cho et al. Mol. Biol. Rep. 2010 20180025 Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue.
4 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
5 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.