Precursor miRBase

  1. Dashboard
  2. Precursor

ssc-mir-15a (MI0008211)

Accession MI0008211
Name ssc-mir-15a
similar to following miRCarta precursors ssc-116.1
Organism Sus scrofa
miRNA ssc-miR-15a
Sequence (5' -> 3')
(79 nts)		 UUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAUUGUGCUGCCUCAAAAAUACAA
MFE -25.10 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Family mir-15 (MIPF0000006)
Experiments
experiment Pubmed link
Illumina 21312241 24499489 19917043
cloned 20180025 18548309
External DBs
Gene symbol MIR15A
NCBI Gene 100316595

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Kim et al. Mamm. Genome 2008 18548309 Identification and characterization of new microRNAs from pig.
2 Nielsen et al. Anim. Genet. 2010 19917043 MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing.
3 Cho et al. Mol. Biol. Rep. 2010 20180025 Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue.
4 Li et al. J. Cell. Biochem. 2011 21312241 MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing.
5 Chen et al. BMC Genomics 2014 24499489 Exploration of microRNAs in porcine milk exosomes.
Imprint Data protection