Precursor miRBase

gga-mir-301b (MI0007565)

Accession MI0007565
Name gga-mir-301b
similar to following miRCarta precursors gga-429-277.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr19:7,193,224-7,193,313 (-)
miRNA gga-miR-301b-5p
miRNA gga-miR-301b-3p
Sequence (5' -> 3')
(90 nts)
GUUGCUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUCACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGAG
MFE -29.90 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
gga-mir-301b
gga-mir-130c
Family mir-130 (MIPF0000034)
Experiments
experiment Pubmed link
Illumina 18469162
Northern blot 18511220

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Shao et al. Gene 2008 18511220 Identification of novel chicken microRNAs and analysis of their genomic organization.
2 Glazov et al. Genome Res. 2008 18469162 A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach.