Precursor miRBase

gga-mir-10a (MI0007559)

Accession MI0007559
Name gga-mir-10a
similar to following miRCarta precursors gga-26886-26885.1
Organism Gallus gallus
Genome Gallus-gallus-4.0
Location chr27:3,620,210-3,620,283 (+)
miRNA gga-miR-10a-5p
miRNA gga-miR-10a-3p
Sequence (5' -> 3')
(74 nts)
CUAUAUGUACCCUGUAGAUCCGAAUUUGUGUAAAGGAAGUUGGGUCACAAAUUCGUAUCUAGGGGAAUAUGUAG
MFE -29.00 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
gga-mir-10a
Family mir-10 (MIPF0000033)
Experiments
experiment Pubmed link
Illumina 18469162

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Glazov et al. Genome Res. 2008 18469162 A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach.
2 Shao et al. Gene 2008 18511220 Identification of novel chicken microRNAs and analysis of their genomic organization.