| Accession | MI0008555 | ||||
| Name | ptr-mir-16-2 | ||||
| similar to following miRCarta precursors | ptr-61.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
3:164,188,432-164,188,511 (+) |
||||
| miRNA | ptr-miR-16 | ||||
| Sequence (5' -> 3') (80 nts) |
UUCCACUCUAGCAGCACGUAAAUAUUGGCGUAGUGAAAUAUAUGUUAAACACCAAUAUUACUGUGCUGCUUUAGUGUGAC | ||||
| MFE | -29.30 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
ptr-mir-15b
ptr-mir-16-2 |
||||
| Family | mir-15 (MIPF0000006) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |