| Accession | MI0007930 | ||||
| Name | mml-mir-933 | ||||
| similar to following miRCarta precursors | mml-1412.1 | ||||
| Organism | Macaca mulatta | ||||
| Genome | CR_1.0 | ||||
| Location |
chr12:38,509,987-38,510,062 (-) |
||||
| miRNA | mml-miR-933 | ||||
| Sequence (5' -> 3') (76 nts) |
CUUGGGUCAGUUCAGAGGUCCUCGGGGCGCGCGUCGAGUCAGCCGUGUGCGCAGGGAGACCUCUCCCACCCACAGU | ||||
| MFE | -31.90 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mml-mir-933 |
||||
| Family | mir-933 (MIPF0000505) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Yue et al. | BMC Genomics | 2008 | 18186931 | Identification of novel homologous microRNA genes in the rhesus macaque genome. |