| Accession | MI0007810 | ||||
| Name | mml-mir-523b | ||||
| similar to following miRCarta precursors | mml-28982.1 | ||||
| Organism | Macaca mulatta | ||||
| Genome | CR_1.0 | ||||
| Location |
chr19:59,566,410-59,566,498 (+) |
||||
| miRNA | mml-miR-523b | ||||
| Sequence (5' -> 3') (89 nts) |
UCUCAUGAUGUGACCCUCUAGAGCGAAGCGCUUUCUGUUGGCUAGAAAAGAAUAGGAAGCGCUUCCCUUUAGAGUGUUACGCUUUGAGA | ||||
| MFE | -45.30 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mml-mir-523b |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Yue et al. | BMC Genomics | 2008 | 18186931 | Identification of novel homologous microRNA genes in the rhesus macaque genome. |