Accession | MI0007810 | ||||
Name | mml-mir-523b | ||||
similar to following miRCarta precursors | mml-28982.1 | ||||
Organism | Macaca mulatta | ||||
Genome | CR_1.0 | ||||
Location |
chr19:59,566,410-59,566,498 (+) |
||||
miRNA | mml-miR-523b | ||||
Sequence (5' -> 3') (89 nts) |
UCUCAUGAUGUGACCCUCUAGAGCGAAGCGCUUUCUGUUGGCUAGAAAAGAAUAGGAAGCGCUUCCCUUUAGAGUGUUACGCUUUGAGA | ||||
MFE | -45.30 kcal/mol | ||||
first miRBase version | 11.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
mml-mir-523b |
||||
Family | mir-515 (MIPF0000020) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Yue et al. | BMC Genomics | 2008 | 18186931 | Identification of novel homologous microRNA genes in the rhesus macaque genome. |