Precursor miRBase

mml-let-7g (MI0007579)

Accession MI0007579
Name mml-let-7g
similar to following miRCarta precursors mml-58-224.1
potential naming conflicts with mml-let-7g-5p (MIMAT0006157)
Organism Macaca mulatta
Genome CR_1.0
Location chr6:88,266,087-88,266,170 (+)
miRNA mml-let-7g-5p
miRNA mml-let-7g-3p
Sequence (5' -> 3')
(84 nts)
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCCA
MFE -39.30 kcal/mol
first miRBase version 11.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mml-let-7g
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
Illumina 23034410
External DBs
Gene symbol MIRLET7G
NCBI Gene 100315390

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Yue et al. BMC Genomics 2008 18186931 Identification of novel homologous microRNA genes in the rhesus macaque genome.
2 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.