| Accession | MI0006436 | ||||
| Name | hsa-mir-1255b-2 | ||||
| similar to following miRCarta precursors | hsa-1084-2274.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:167,998,660-167,998,726 (+) |
||||
| miRNA | hsa-miR-1255b-5p | ||||
| miRNA | hsa-miR-1255b-2-3p | ||||
| Sequence (5' -> 3') (67 nts) |
UCUUACGGAUGAGCAAAGAAAGUGGUUUGCGCCUCAAGAAACCACUUUCUUUGCUCAUCCAUAAGGA | ||||
| MFE | -40.60 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-1255b-2 |
||||
| Family | mir-1255 (MIPF0000506) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Morin et al. | Genome Res. | 2008 | 18285502 | Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. |