| Accession | MI0006417 | ||||
| Name | hsa-mir-302e | ||||
| similar to following miRCarta precursors | hsa-1011.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr11:7,234,766-7,234,837 (+) |
||||
| miRNA | hsa-miR-302e | ||||
| Sequence (5' -> 3') (72 nts) |
UUGGGUAAGUGCUUCCAUGCUUCAGUUUCCUUACUGGUAAGAUGGAUGUAGUAAUAGCACCUACCUUAUAGA | ||||
| MFE | -21.50 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-302e |
||||
| Family | mir-302_2 (MIPF0000658) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Morin et al. | Genome Res. | 2008 | 18285502 | Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. |