Accession | MI0006412 | ||||
Name | hsa-mir-548h-2 | ||||
similar to following miRCarta precursors | hsa-1061.2 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr16:11,306,440-11,306,527 (-) |
||||
miRNA | hsa-miR-548h-5p | ||||
Sequence (5' -> 3') (88 nts) |
GUAUUAGGUUGGUGCAAAAGUAAUCGCGGUUUUUGUCAUUACUUUCAAUGGCAAACACCACAAUUACUUUUGCACCAACCUAAUAUAA | ||||
MFE | -48.00 kcal/mol | ||||
first miRBase version | 11.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-548h-2 |
||||
Family | mir-548 (MIPF0000317) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Morin et al. | Genome Res. | 2008 | 18285502 | Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. |