Accession | MI0006273 | ||||
Name | hsa-mir-1180 | ||||
similar to following miRCarta precursors | hsa-1549-214.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr17:19,344,506-19,344,574 (-) |
||||
miRNA | hsa-miR-1180-5p | ||||
miRNA | hsa-miR-1180-3p | ||||
Sequence (5' -> 3') (69 nts) |
GCUGCUGGACCCACCCGGCCGGGAAUAGUGCUCCUGGUUGUUUCCGGCUCGCGUGGGUGUGUCGGCGGC | ||||
MFE | -39.00 kcal/mol | ||||
first miRBase version | 11.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
hsa-mir-1180 |
||||
Family | mir-1180 (MIPF0000789) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Subramanian et al. | Oncogene | 2008 | 17922033 | MicroRNA expression signature of human sarcomas. |
2 | Nygaard et al. | BMC Med Genomics | 2009 | 19508715 | Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing. |
3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |