| Accession | MI0003814 | ||||
| Name | hsa-mir-1271 | ||||
| similar to following miRCarta precursors | hsa-380-1193.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr5:176,367,946-176,368,031 (+) |
||||
| miRNA | hsa-miR-1271-5p | ||||
| miRNA | hsa-miR-1271-3p | ||||
| Sequence (5' -> 3') (86 nts) |
CACCCAGAUCAGUGCUUGGCACCUAGCAAGCACUCAGUAAAUAUUUGUUGAGUGCCUGCUAUGUGCCAGGCAUUGUGCUGAGGGCU | ||||
| MFE | -51.80 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-1271 |
||||
| Family | mir-1271 (MIPF0000483) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Morin et al. | Genome Res. | 2008 | 18285502 | Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. |
| 3 | Nygaard et al. | BMC Med Genomics | 2009 | 19508715 | Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing. |