| Accession | MI0003758 | ||||
| Name | hsa-mir-1264 | ||||
| similar to following miRCarta precursors | hsa-1112.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:114,652,655-114,652,723 (+) |
||||
| miRNA | hsa-miR-1264 | ||||
| Sequence (5' -> 3') (69 nts) |
AGGUCCUCAAUAAGUAUUUGUUGAAAGAAUAAAUAAACCAACAAGUCUUAUUUGAGCACCUGUUAUGUG | ||||
| MFE | -19.10 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-1912
hsa-mir-1264 |
||||
| Family | mir-95 (MIPF0000098) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Morin et al. | Genome Res. | 2008 | 18285502 | Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. |