| Accession | MI0005755 | ||||
| Name | hsa-mir-933 | ||||
| similar to following miRCarta precursors | hsa-1412.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr2:175,167,633-175,167,709 (-) |
||||
| miRNA | hsa-miR-933 | ||||
| Sequence (5' -> 3') (77 nts) |
ACUUGGGUCAGUUCAGAGGUCCUCGGGGCGCGCGUCGAGUCAGCCGUGUGCGCAGGGAGACCUCUCCCACCCACAGU | ||||
| MFE | -32.60 kcal/mol | ||||
| first miRBase version | 10.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-933 |
||||
| Family | mir-933 (MIPF0000505) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |