| Accession | MI0005566 | ||||
| Name | hsa-mir-374b | ||||
| similar to following miRCarta precursors | hsa-153-446.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:74,218,547-74,218,618 (-) |
||||
| miRNA | hsa-miR-374b-5p | ||||
| miRNA | hsa-miR-374b-3p | ||||
| Sequence (5' -> 3') (72 nts) |
ACUCGGAUGGAUAUAAUACAACCUGCUAAGUGUCCUAGCACUUAGCAGGUUGUAUUAUCAUUGUCCGUGUCU | ||||
| MFE | -40.30 kcal/mol | ||||
| first miRBase version | 10.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-421
hsa-mir-374b hsa-mir-374c |
||||
| Family | mir-374 (MIPF0000288) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |