Precursor miRBase

mmu-mir-598 (MI0005556)

Accession MI0005556
Name mmu-mir-598
similar to following miRCarta precursors mmu-25338-25337.1
Organism Mus musculus
Genome GRCm38.p5
Location chr14:63,727,189-63,727,267 (+)
miRNA mmu-miR-598-5p
miRNA mmu-miR-598-3p
Sequence (5' -> 3')
(79 nts)
GCUGAUGCUGGCGGUGAUGCCGAUGGUGCGAGCUGAAAAUGGGCUGCUACGUCAUCGUCGUCAUCGUUAUCAUCAUCAU
MFE -33.00 kcal/mol
first miRBase version 10.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-598
Family mir-598 (MIPF0000393)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir598
NCBI Gene 100124452

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Berezikov et al. Genome Res. 2006 16954537 Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.