Accession | MI0005552 | ||||
Name | mmu-mir-208b | ||||
similar to following miRCarta precursors | mmu-25327-846.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr14:54,975,700-54,975,776 (-) |
||||
miRNA | mmu-miR-208b-5p | ||||
miRNA | mmu-miR-208b-3p | ||||
Sequence (5' -> 3') (77 nts) |
CCUCUCAGGGAAGCUUUUUGCUCGCGUUAUGUUUCUCAUCCGAAUAUAAGACGAACAAAAGGUUUGUCUGAGGGCUG | ||||
MFE | -32.20 kcal/mol | ||||
first miRBase version | 10.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
mmu-mir-208b |
||||
Family | mir-208 (MIPF0000178) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Calabrese et al. | Proc. Natl. Acad. Sci. U.S.A. | 2007 | 17989215 | RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |