| Accession | MI0005532 | ||||
| Name | hsa-mir-874 | ||||
| similar to following miRCarta precursors | hsa-526-199.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr5:137,647,572-137,647,649 (-) |
||||
| miRNA | hsa-miR-874-5p | ||||
| miRNA | hsa-miR-874-3p | ||||
| Sequence (5' -> 3') (78 nts) |
UUAGCCCUGCGGCCCCACGCACCAGGGUAAGAGAGACUCUCGCUUCCUGCCCUGGCCCGAGGGACCGACUGGCUGGGC | ||||
| MFE | -36.40 kcal/mol | ||||
| first miRBase version | 10.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-874 |
||||
| Family | mir-874 (MIPF0000401) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |