| Accession | MI0005725 | ||||
| Name | cgr-mir-21 | ||||
| similar to following miRCarta precursors | cgr-1-25100.1 | ||||
| Organism | Cricetulus griseus | ||||
| miRNA | cgr-miR-21-5p | ||||
| miRNA | cgr-miR-21-3p | ||||
| Sequence (5' -> 3') (92 nts) |
UGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUC | ||||
| MFE | -42.60 kcal/mol | ||||
| first miRBase version | 9.2 | ||||
| last miRBase version | 21.0 | ||||
| Family | mir-21 (MIPF0000060) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gammell et al. | J. Biotechnol. | 2007 | 17570552 | Initial identification of low temperature and culture stage induction of miRNA expression in suspension CHO-K1 cells. |
| 2 | Hackl et al. | J. Biotechnol. | 2011 | 21392545 | Next-generation sequencing of the Chinese hamster ovary microRNA transcriptome: Identification, annotation and profiling of microRNAs as targets for cellular engineering. |