| Accession | MI0005465 | ||||
| Name | bta-mir-365-1 | ||||
| similar to following miRCarta precursors | bta-595-176.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr25:13,344,234-13,344,320 (+) |
||||
| miRNA | bta-miR-365-5p | ||||
| miRNA | bta-miR-365-3p | ||||
| Sequence (5' -> 3') (87 nts) |
ACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUGCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCA | ||||
| MFE | -34.50 kcal/mol | ||||
| first miRBase version | 9.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-193b
bta-mir-365-1 |
||||
| Family | mir-365 (MIPF0000061) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 2 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |
| 3 | Glazov et al. | PLoS ONE | 2009 | 19633723 | Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. |