Accession | MI0005461 | ||||
Name | bta-mir-19b | ||||
similar to following miRCarta precursors | bta-122.1 | ||||
Organism | Bos taurus | ||||
Genome | UMD3.1 | ||||
Location |
chr12:66,227,133-66,227,219 (+) |
||||
miRNA | bta-miR-19b | ||||
Sequence (5' -> 3') (87 nts) |
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAGUG | ||||
MFE | -38.50 kcal/mol | ||||
first miRBase version | 9.2 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
bta-mir-17
bta-mir-18a bta-mir-19a bta-mir-20a bta-mir-19b bta-mir-92a-1 |
||||
Family | mir-19 (MIPF0000011) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
2 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |