| Accession | MI0005455 | ||||
| Name | bta-let-7e | ||||
| similar to following miRCarta precursors | bta-50.1 | ||||
| potential naming conflicts with | bta-let-7e (MIMAT0004333) | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr18:58,015,036-58,015,114 (+) |
||||
| miRNA | bta-let-7e | ||||
| Sequence (5' -> 3') (79 nts) |
CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCACUAUACGGCCUCCUAGCUUUCCCCAGG | ||||
| MFE | -36.70 kcal/mol | ||||
| first miRBase version | 9.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
bta-mir-99b
bta-let-7e bta-mir-125a |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |