| Accession | MI0005207 | ||||
| Name | mmu-mir-743a | ||||
| similar to following miRCarta precursors | mmu-25662-25661.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chrX:66,776,757-66,776,818 (-) |
||||
| miRNA | mmu-miR-743a-5p | ||||
| miRNA | mmu-miR-743a-3p | ||||
| Sequence (5' -> 3') (62 nts) |
CUGUAUUCAGAUUGGUGCCUGUCAUGUUUAUAAGAAUGAAAGACACCAAGCUGAGUAGAGUA | ||||
| MFE | -23.00 kcal/mol | ||||
| first miRBase version | 9.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (4 precursors) |
mmu-mir-743a mmu-mir-743b mmu-mir-742 mmu-mir-883a |
||||
| Family | mir-743 (MIPF0000386) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |