| Accession | MI0005206 | ||||||
| Name | mmu-mir-742 | ||||||
| similar to following miRCarta precursors | mmu-25666-25665.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chrX:66,780,373-66,780,437 (-) |
||||||
| miRNA | mmu-miR-742-5p | ||||||
| miRNA | mmu-miR-742-3p | ||||||
| Sequence (5' -> 3') (65 nts) |
UGCUCUACUCACAUGGUUGCUAAUCACGUGAAGUGUAGGUGAAAGCCACCAUGCUGGGUAAAGUA | ||||||
| MFE | -25.90 kcal/mol | ||||||
| first miRBase version | 9.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (5 precursors) |
mmu-mir-743a
mmu-mir-743b mmu-mir-742 mmu-mir-883a mmu-mir-883b |
||||||
| Family | mir-742 (MIPF0000412) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 2 | Calabrese et al. | Proc. Natl. Acad. Sci. U.S.A. | 2007 | 17989215 | RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |