Precursor miRBase

bmo-mir-10 (MI0004973)

Accession MI0004973
Name bmo-mir-10
similar to following miRCarta precursors bmo-30114-30113.1
Organism Bombyx mori
Genome SILKDB2.0
Location nscaf2853:2,508,128-2,508,211 (-)
miRNA bmo-miR-10-5p
miRNA bmo-miR-10-3p
Sequence (5' -> 3')
(84 nts)
AGUGCCCUACAUCUACCCUGUAGAUCCGAAUUUGUUUGAAGUGAGGCGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUGCACG
MFE -39.20 kcal/mol
first miRBase version 9.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bmo-mir-10
Family mir-10 (MIPF0000033)
Experiments
experiment Pubmed link
Illumina 20199675

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Tong et al. J Zhejiang Univ Sci B 2006 16972323 Computational prediction of microRNA genes in silkworm genome.
2 He et al. BMC Genomics 2008 18507836 Identification and characteristics of microRNAs from Bombyx mori.
3 Yu et al. PLoS ONE 2008 18714353 The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages.
4 Cao et al. Insect Biochem. Mol. Biol. 2008 18977439 Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system.
5 Liu et al. BMC Genomics 2010 20199675 MicroRNAs of Bombyx mori identified by Solexa sequencing.