| Accession | MI0004973 | ||||
| Name | bmo-mir-10 | ||||
| similar to following miRCarta precursors | bmo-30114-30113.1 | ||||
| Organism | Bombyx mori | ||||
| Genome | SILKDB2.0 | ||||
| Location |
nscaf2853:2,508,128-2,508,211 (-) |
||||
| miRNA | bmo-miR-10-5p | ||||
| miRNA | bmo-miR-10-3p | ||||
| Sequence (5' -> 3') (84 nts) |
AGUGCCCUACAUCUACCCUGUAGAUCCGAAUUUGUUUGAAGUGAGGCGACAAAUUCGGUUCUAGAGAGGUUUGUGUGGUGCACG | ||||
| MFE | -39.20 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bmo-mir-10 |
||||
| Family | mir-10 (MIPF0000033) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tong et al. | J Zhejiang Univ Sci B | 2006 | 16972323 | Computational prediction of microRNA genes in silkworm genome. |
| 2 | He et al. | BMC Genomics | 2008 | 18507836 | Identification and characteristics of microRNAs from Bombyx mori. |
| 3 | Yu et al. | PLoS ONE | 2008 | 18714353 | The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages. |
| 4 | Cao et al. | Insect Biochem. Mol. Biol. | 2008 | 18977439 | Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system. |
| 5 | Liu et al. | BMC Genomics | 2010 | 20199675 | MicroRNAs of Bombyx mori identified by Solexa sequencing. |