| Accession | MI0005375 | ||||
| Name | mdo-mir-367 | ||||
| similar to following miRCarta precursors | mdo-27570.1 | ||||
| Organism | Monodelphis domestica | ||||
| Genome | monDom5 | ||||
| Location |
chr5:66,074,337-66,074,399 (-) |
||||
| miRNA | mdo-miR-367 | ||||
| Sequence (5' -> 3') (63 nts) |
ACUGUUGCUAACAUGCAACUCUGUUCUAUGUAAACGGGAAUUGCACUUUAGCAAUGGUGAUGG | ||||
| MFE | -21.10 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
mdo-mir-367 mdo-mir-302d mdo-mir-302a mdo-mir-302c mdo-mir-302b |
||||
| Family | mir-367 (MIPF0000162) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |