Accession | MI0005370 | ||||
Name | mdo-mir-25 | ||||
similar to following miRCarta precursors | mdo-23.1 | ||||
Organism | Monodelphis domestica | ||||
Genome | monDom5 | ||||
Location |
chr2:257,690,280-257,690,362 (+) |
||||
miRNA | mdo-miR-25 | ||||
Sequence (5' -> 3') (83 nts) |
GGCCAGUGUUGAGAGGCGGAGACUUGGGCAAUUGCUGAACUCUGCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCUGGC | ||||
MFE | -36.10 kcal/mol | ||||
first miRBase version | 9.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
mdo-mir-93
mdo-mir-25 |
||||
Family | mir-25 (MIPF0000013) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |