Accession | MI0005358 | ||||
Name | mdo-mir-19b-1 | ||||
similar to following miRCarta precursors | mdo-363-122.1 | ||||
Organism | Monodelphis domestica | ||||
Genome | monDom5 | ||||
Location |
chr7:108,468,305-108,468,393 (-) |
||||
miRNA | mdo-miR-19b-1-5p | ||||
miRNA | mdo-miR-19b-3p | ||||
Sequence (5' -> 3') (89 nts) |
GCACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUGAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGUGG | ||||
MFE | -39.20 kcal/mol | ||||
first miRBase version | 9.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (6 precursors) |
mdo-mir-92a-1
mdo-mir-19b-1 mdo-mir-20a mdo-mir-19a mdo-mir-18a mdo-mir-17 |
||||
Family | mir-19 (MIPF0000011) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |
2 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |