| Accession | MI0005351 | ||||||
| Name | mdo-let-7b | ||||||
| similar to following miRCarta precursors | mdo-14.1 | ||||||
| potential naming conflicts with | mdo-let-7b (MIMAT0004162) | ||||||
| Organism | Monodelphis domestica | ||||||
| Genome | monDom5 | ||||||
| Location |
chr8:11,048,200-11,048,287 (-) |
||||||
| miRNA | mdo-let-7b | ||||||
| Sequence (5' -> 3') (88 nts) |
GGCGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGUAGUGAUUUUGCCCCAAUCAGAAGAUAACUAUACAACCUACUGCCUUCCCUGA | ||||||
| MFE | -46.60 kcal/mol | ||||||
| first miRBase version | 9.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
mdo-let-7b mdo-let-7a-3 |
||||||
| Family | let-7 (MIPF0000002) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |