Precursor miRBase

mdo-mir-181a-1 (MI0005343)

Accession MI0005343
Name mdo-mir-181a-1
similar to following miRCarta precursors mdo-32-28139.1
Organism Monodelphis domestica
Genome monDom5
Location chr2:99,873,079-99,873,142 (-)
miRNA mdo-miR-181a-5p
miRNA mdo-miR-181a-1-3p
Sequence (5' -> 3')
(64 nts)
UGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUGAAAACCAUCGACCGUUGAUUGUACC
MFE -21.00 kcal/mol
first miRBase version 9.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mdo-mir-181b-1
mdo-mir-181a-1
Family mir-181 (MIPF0000007)
Experiments
experiment Pubmed link
Illumina 23034410
External DBs
Gene symbol MIR181A-1
NCBI Gene 100034280

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Devor et al. J. Hered. 2008 17965199 In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica.
2 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.