| Accession | MI0005331 | ||||
| Name | mdo-let-7g | ||||
| similar to following miRCarta precursors | mdo-58-224.1 | ||||
| potential naming conflicts with | mdo-let-7g-5p (MIMAT0004142) | ||||
| Organism | Monodelphis domestica | ||||
| Genome | monDom5 | ||||
| Location |
chr6:277,022,691-277,022,773 (+) |
||||
| miRNA | mdo-let-7g-5p | ||||
| miRNA | mdo-let-7g-3p | ||||
| Sequence (5' -> 3') (83 nts) |
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCC | ||||
| MFE | -38.00 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mdo-let-7g |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |
| 2 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |