| Accession | MI0005324 | ||||
| Name | mdo-mir-223 | ||||
| similar to following miRCarta precursors | mdo-28451-120.1 | ||||
| Organism | Monodelphis domestica | ||||
| Genome | monDom5 | ||||
| Location |
chrX:10,078,238-10,078,348 (-) |
||||
| miRNA | mdo-miR-223-5p | ||||
| miRNA | mdo-miR-223-3p | ||||
| Sequence (5' -> 3') (111 nts) |
UCUGGCCCAGAUCCUUCAGUGCCACACUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCGUGUCGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGAGGCAUUUGCCUAG | ||||
| MFE | -40.50 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mdo-mir-223 |
||||
| Family | mir-223 (MIPF0000067) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |
| 2 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |