Accession | MI0005323 | ||||
Name | mdo-mir-219-1 | ||||
similar to following miRCarta precursors | mdo-860-841.1 | ||||
Organism | Monodelphis domestica | ||||
Genome | monDom5 | ||||
Location |
chr1:454,138,610-454,138,700 (-) |
||||
miRNA | mdo-miR-219-5p | ||||
miRNA | mdo-miR-219-1-3p | ||||
Sequence (5' -> 3') (91 nts) |
CAGGGGUUCCGCCGCUGAUUGUCCAAACGCAAUUCUUGUGCGAGUCUGCAGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGCUGAGCUCC | ||||
MFE | -47.10 kcal/mol | ||||
first miRBase version | 9.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
mdo-mir-219-1 |
||||
Family | mir-219 (MIPF0000044) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |
2 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |