Accession | MI0005321 | ||||
Name | mdo-mir-217 | ||||
similar to following miRCarta precursors | mdo-311.1 | ||||
Organism | Monodelphis domestica | ||||
Genome | monDom5 | ||||
Location |
chr1:638,507,640-638,507,721 (+) |
||||
miRNA | mdo-miR-217 | ||||
Sequence (5' -> 3') (82 nts) |
UUGAUGUCGUAGAUACUGCAUCAGGAACUGAUUGGAUAAUAUUCAGGCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCU | ||||
MFE | -27.70 kcal/mol | ||||
first miRBase version | 9.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
mdo-mir-217 |
||||
Family | mir-217 (MIPF0000077) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |