| Accession | MI0005320 | ||||||
| Name | mdo-mir-216 | ||||||
| similar to following miRCarta precursors | mdo-778.1 | ||||||
| Organism | Monodelphis domestica | ||||||
| Genome | monDom5 | ||||||
| Location |
chr1:638,493,848-638,493,944 (+) |
||||||
| miRNA | mdo-miR-216 | ||||||
| Sequence (5' -> 3') (97 nts) |
GAUGGCUGUGAAUUGGCUUAAUCUCAGCUGGCAACUGUGAGAUGUUAAUAAAUUCCCUCACAGUGGUCUCUGGGAUUAUGCUAAACAGAGCAAUUUC | ||||||
| MFE | -37.90 kcal/mol | ||||||
| first miRBase version | 9.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
mdo-mir-216 |
||||||
| Family | mir-216 (MIPF0000054) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |