| Accession | MI0005304 | ||||
| Name | mdo-mir-451 | ||||
| similar to following miRCarta precursors | mdo-28186.1 | ||||
| Organism | Monodelphis domestica | ||||
| Genome | monDom5 | ||||
| Location |
chr2:506,777,375-506,777,436 (-) |
||||
| miRNA | mdo-miR-451 | ||||
| Sequence (5' -> 3') (62 nts) |
CUGGCGGGGAAACCGUUACCAUUACUGUGUUUAGUAAUGGUAAGGGUUCUCCCGCUGCGCUG | ||||
| MFE | -36.00 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
mdo-mir-451 mdo-mir-144 |
||||
| Family | mir-451 (MIPF0000148) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |