| Accession | MI0004310 | ||||||||
| Name | mmu-mir-764 | ||||||||
| similar to following miRCarta precursors | mmu-25744-25743.1 | ||||||||
| Organism | Mus musculus | ||||||||
| Genome | GRCm38.p5 | ||||||||
| Location |
chrX:147,002,259-147,002,366 (+) |
||||||||
| miRNA | mmu-miR-764-5p | ||||||||
| miRNA | mmu-miR-764-3p | ||||||||
| Sequence (5' -> 3') (108 nts) |
UCAACACAAUCUGAAUCUUGGAGGCAGGUGCUCACAUGUCCUCCUCCAUGCUUAUAAAUACAUGGAGGAGGCCAUAGUGGCAACUGUCACCAUGAUUGAUUUCGUUGG | ||||||||
| MFE | -49.60 kcal/mol | ||||||||
| first miRBase version | 9.0 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (4 precursors) |
mmu-mir-3552
mmu-mir-764 mmu-mir-1912 mmu-mir-1264 |
||||||||
| Family | mir-764 (MIPF0000707) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |