| Accession | MI0004131 | ||||
| Name | mmu-mir-551b | ||||
| similar to following miRCarta precursors | mmu-24400-24399.1 | ||||
| Organism | Mus musculus | ||||
| Genome | GRCm38.p5 | ||||
| Location |
chr3:29,416,823-29,416,920 (+) |
||||
| miRNA | mmu-miR-551b-5p | ||||
| miRNA | mmu-miR-551b-3p | ||||
| Sequence (5' -> 3') (98 nts) |
GUGCUCUUGUGGCCCAUGAAAUCAAGCUUGGGUGAGACCUGGUGCAGAACAGGAAGGCGACCCAUACUUGGUUUCAGUGGCUGCAAGAAUGACUGCAU | ||||
| MFE | -44.10 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-551b |
||||
| Family | mir-551 (MIPF0000360) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |