| Accession | MI0005066 | ||||
| Name | bta-mir-23b | ||||
| similar to following miRCarta precursors | bta-25291-42.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr8:83,009,615-83,009,674 (+) |
||||
| miRNA | bta-miR-23b-5p | ||||
| miRNA | bta-miR-23b-3p | ||||
| Sequence (5' -> 3') (60 nts) |
GGGUUCCUGGCAUGCUGAUUUGUGACUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCAC | ||||
| MFE | -22.00 kcal/mol | ||||
| first miRBase version | 8.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (4 precursors) |
bta-mir-2475
bta-mir-23b bta-mir-27b bta-mir-24-1 |
||||
| Family | mir-23 (MIPF0000027) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 2 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 3 | Glazov et al. | PLoS ONE | 2009 | 19633723 | Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. |