| Accession | MI0005055 | ||||||
| Name | bta-mir-200b | ||||||
| similar to following miRCarta precursors | bta-27765.1 | ||||||
| Organism | Bos taurus | ||||||
| Genome | UMD3.1 | ||||||
| Location |
chr16:52,521,992-52,522,050 (-) |
||||||
| miRNA | bta-miR-200b | ||||||
| Sequence (5' -> 3') (59 nts) |
CCAUCUUACUGGGCAGCAUUGGAUGGUGUCUGGUCUCUAAUACUGCCUGGUAAUGAUGA | ||||||
| MFE | -24.80 kcal/mol | ||||||
| first miRBase version | 8.2 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
bta-mir-429
bta-mir-200a bta-mir-200b |
||||||
| Family | mir-8 (MIPF0000019) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Huang et al. | Int. J. Biol. Sci. | 2011 | 21912509 | Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle. |