| Accession | MI0005051 | ||||
| Name | bta-let-7g | ||||
| similar to following miRCarta precursors | bta-58.1 | ||||
| potential naming conflicts with | bta-let-7g (MIMAT0003838) | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr22:49,189,340-49,189,422 (+) |
||||
| miRNA | bta-let-7g | ||||
| Sequence (5' -> 3') (83 nts) |
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCC | ||||
| MFE | -38.00 kcal/mol | ||||
| first miRBase version | 8.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
bta-let-7g |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |